Suggested problems

https://www.dnaindia.com/health/report-oprah-winfrey-keto-gummies-scam-warning-alert-shocking-oprah-keto-gummies-news-revealed-2963875

July 3, 2022, 9:52 a.m. by scillanally

Biological Motivation

Oprah Winfrey Keto Gummies These are a few traditional causes of overweight and weight problems-associated health troubles. For the frame to characteristic nicely, such situations must be prevented. As a end result, individuals are trying to find a wholesome and natural way to shed pounds while not having any terrible effects on their our bodies. Tell us about a wonderful product that promotes the frame's widespread health whilst helping with fat burning. https://www.dnaindia.com/health/report-oprah-winfrey-keto-gummies-scam-warning-alert-shocking-oprah-keto-gummies-news-revealed-2963875

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21