Suggested problems

https://www.outlookindia.com/outlook-spotlight/prodentim-is-it-worth-my-money--news-205306

July 3, 2022, 7:45 a.m. by telleqrnally

Biological Motivation

ProDentim ProDentim must be taken each morning with water. You will experience healthier universal, so eating right and exercise often are essential. Limit your ProDentim intake to the day by day recommended dose. This oral supplement should not be utilized by pregnant or nursing mothers, kids below 18 years of age, and those with scientific conditions. Do now not use this product if the protecting seal is broken or missing. https://www.outlookindia.com/outlook-spotlight/prodentim-is-it-worth-my-money--news-205306 https://www.dnaindia.com/health/report-oprah-winfrey-keto-gummies-scam-warning-alert-shocking-oprah-keto-gummies-news-revealed-2963875

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21