Suggested problems

BlockchainX

July 2, 2022, 10:05 a.m. by bridgesmartcontract

Biological Motivation

The future is cross-chain and you can do that now a token bridge. A cross-chain bridge let's you launch your token on multiple blockchains and allow users send your tokens between chains. Launch your token on any EVM blockchain with our cross-chain bridge. https://www.blockchainx.tech/bridge-smart-contract-development A cross-chain bridge allows you to launch your token on multiple blockchains. The bridge is essentially a smart contract that we deploy on 2 or more chains and facilitates the movement of tokens between the blockchains. When a user wants to send tokens from one blockchain to another, they can connect to the bridge through the web application with their web3 wallet. The tokens are locked inside a smart contract and the corresponding number of tokens are minted on the other blockchain. When the opposite happens, the newly minted tokens are burned and the smart contract on the first [BlockchainX][1] unlocks the tokens. In case both tokens have the mint functionality, this process can happen without token locking through minting and burning alone.

[1]: https://www.blockchainx.tech/bridge-smart-contract-development

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21