Suggested problems

https://www.outlookindia.com/outlook-spotlight/prodentim-is-it-worth-my-money--news-205306

July 2, 2022, 6:48 a.m. by remiahnally

Biological Motivation

ProDentim This herb has a beautiful heady scent and can be used to make cosmetics, soaps or other products with perfume. It has many medicinal uses, inclusive of the oil used to deal with joint pain, hair loss and itching. https://www.outlookindia.com/outlook-spotlight/prodentim-is-it-worth-my-money--news-205306 https://www.dnaindia.com/health/report-oprah-winfrey-keto-gummies-scam-warning-alert-shocking-oprah-keto-gummies-news-revealed-2963875

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21