Suggested problems

https://www.outlookindia.com/outlook-spotlight/truly-keto-acv-gummies-review-truly-keto-gummies-pills-scam-or-real-weight-loss-results-news-205527

July 1, 2022, 10:03 a.m. by onxorenally

Biological Motivation

Truly Keto ACV Gummies As long as you preserve a state of ketosis, you may retain to consume fat weekly. Finally, you will note that your garments suit higher because of your efforts to shed some kilos continuously. Because of this, Keto is the best technique to dropping weight and attaining a greater petite, toned physique. https://www.outlookindia.com/outlook-spotlight/truly-keto-acv-gummies-review-truly-keto-gummies-pills-scam-or-real-weight-loss-results-news-205527 https://www.outlookindia.com/outlook-spotlight/goli-sleep-gummies-beware-alarming-negative-scam-alerts--news-205520 https://www.outlookindia.com/outlook-spotlight/ree-drummond-cbd-gummies-ree-drummond-scam-exposed-2022-price-official-website-news-205523 https://www.outlookindia.com/outlook-spotlight/purekana-gummies-latest-updated-reviews-2022-does-pure-kana-cbd-gummies-work-or-scam--news-205516 https://www.outlookindia.com/outlook-spotlight/keto-blast-gummy-bears-keto-blast-gummies-shark-tank-shocking-scam-warning--news-205514

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21