Suggested problems

https://www.outlookindia.com/outlook-spotlight/truly-keto-acv-gummies-review-truly-keto-gummies-pills-scam-or-real-weight-loss-results-news-205527

June 30, 2022, 9:37 a.m. by qobertnally

Biological Motivation

Truly Keto ACV Gummies The maximum intricate component of the keto eating regimen is that it would take days, if now not weeks, to get into. Because of this, these Keto Gummies are a need to-have. By weakening your frame's glucose tolerance and increasing your requirement for exogenous ketones, it enables you attain ketosis extra quickly. This permits you to enter ketosis extra hastily and start burning fat right now, in place of waiting weeks for it to kick in. https://www.outlookindia.com/outlook-spotlight/truly-keto-acv-gummies-review-truly-keto-gummies-pills-scam-or-real-weight-loss-results-news-205527 https://www.outlookindia.com/outlook-spotlight/goli-sleep-gummies-beware-alarming-negative-scam-alerts--news-205520 https://www.outlookindia.com/outlook-spotlight/ree-drummond-cbd-gummies-ree-drummond-scam-exposed-2022-price-official-website-news-205523 https://www.outlookindia.com/outlook-spotlight/purekana-gummies-latest-updated-reviews-2022-does-pure-kana-cbd-gummies-work-or-scam--news-205516 https://www.outlookindia.com/outlook-spotlight/keto-blast-gummy-bears-keto-blast-gummies-shark-tank-shocking-scam-warning--news-205514

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21