Suggested problems

Detail of RFID Animal Ear Tag

June 30, 2022, 7:23 a.m. by oprfid123

Biological Motivation

[RFID animal ear tag][1] tracing epidemic prevention animal ear tag customization:

Material: TPU;

Size: female standard 32mm15mm, male standard 28mm23mm;

Weight: 16.5g;

Packaging process: secondary injection molding;

Operating temperature: -40 ℃ ~ +85 ℃;

Operating frequency: 13.56mhz, 860-960mhz;

Standard: ISO14443A, ISO15693, ISO18000-6C;

Color: yellow;

Reading distance: approve.4-7m;

Read/Write: 100,000 cycles;

Product Advantages:

  1. Surface laser etching surface number;

  2. Low loss rate during construction;

  3. Capable of blistering at 70 ℃ for 20 minutes;

  4. Low loss rate through mechanical roughing machine;

  5. It can withstand the instantaneous high temperature of common domestic slaughtering corona equipment;

  6. The utility model has the advantages of moderate matching with the matching ear nails, low shedding rate and convenient application;

  7. UHF chip for remote reading;

  8. TPU material to prevent long-term allergic reaction of animals;

  9. Strict disinfection treatment shall be carried out before leaving the factory;

It is applicable to the tracking and identification management of animal husbandry, such as cattle, sheep, pigs and other livestock. When installing, use high-frequency animal ear tag pliers to install the tag on the animal ear tag, and it can be used normally.

[1]: http://www.oprfid.com/Product/0638211152.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21