Suggested problems

Truly Keto ACV Gummies To keep

June 29, 2022, 1:13 p.m. by orwxinnally

Biological Motivation

Truly Keto ACV Gummies To keep away from gaining weight and exhaustion, unnecessary carb fixings should now not be used inside the casing, as they contribute to fats accumulation inside the body. These Keto Gummies paintings clearly to help you lose weight and maintain a healthful way of life. It teaches BHB ketones a way to enhance the kingdom of ketosis inside the frame. As a end result of being in ketosis, the body is pressured to rely upon fats for power rather than carbohydrates. https://www.outlookindia.com/outlook-spotlight/truly-keto-acv-gummies-review-truly-keto-gummies-pills-scam-or-real-weight-loss-results-news-205527 https://www.outlookindia.com/outlook-spotlight/goli-sleep-gummies-beware-alarming-negative-scam-alerts--news-205520 https://www.outlookindia.com/outlook-spotlight/ree-drummond-cbd-gummies-ree-drummond-scam-exposed-2022-price-official-website-news-205523 https://www.outlookindia.com/outlook-spotlight/purekana-gummies-latest-updated-reviews-2022-does-pure-kana-cbd-gummies-work-or-scam--news-205516 https://www.outlookindia.com/outlook-spotlight/keto-blast-gummy-bears-keto-blast-gummies-shark-tank-shocking-scam-warning--news-205514

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21