Suggested problems

https://www.outlookindia.com/outlook-spotlight/condor-cbd-gummies-hoax-alert-2022-shark-tank-tinnitus-where-to-buy--news-199263

June 29, 2022, 9:59 a.m. by edricknall

Biological Motivation

Condor CBD Gummies Condor CBD Gummies are the advanced formulation to control your wellness and optimize the inner and external functioning. The oral gummies paintings successfully in a unique manner to restore your wellbeing and it promotes quicker healing effects for all continual situations. The oral gummies paintings through targeting the receptors in your body. The substances in the method goal the important thing receptors of your frame and those receptors help in optimizing the functioning of your ECS machine. Since it restores the features of receptors, it optimizes and regulates the ECS gadget to manipulate main functioning. It helps controlling the ingesting behavior, sleep styles, cognitive capabilities or even the pain and aches across the body. It restores the well being with the aid of improving the bodily functions and reduces the age associated persistent disorders from root reason. https://www.outlookindia.com/outlook-spotlight/condor-cbd-gummies-hoax-alert-2022-shark-tank-tinnitus-where-to-buy--news-199263 https://www.outlookindia.com/business-spotlight/keto-blast-gummies-reviews-get-facts-on-fastfit-keto-diet-pills-news-198319 https://www.outlookindia.com/outlook-spotlight/prodentim-is-it-worth-my-money--news-205306 https://www.outlookindia.com/outlook-spotlight/simply-health-acv-keto-gummies-warning-shocking-shark-tank-2022-reviews-to-know-scam-before-buying--news-200608

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21