Suggested problems

Top 10 best Hanoi vip massage parlors recommended for tourists

June 29, 2022, 4:50 a.m. by Vietnam Trips

Check out top 10 best Hanoi vip massage parlors

best hanoi vip massage

After a day of travel, there are so many things that make you extremely tired and stressed, requiring the opportunity to relieve the pressure and restore energy for the next day. You can go to Hanoi vip massage parlors to enjoy the most professional treatments and services, relax your body and mind.

1 - Viet Care

As one of the leading units in care and beauty services in Hanoi, Viet Care is especially trusted and chosen by women. Not only that, the unit also provides many reputable beauty care products for domestic and foreign markets. With more than 10 years of experience and 26 branches across the country, Viet Care is confident to be the leading vip massage parlor in Hanoi.

2 - Neko Massage

In contrast, Neko Massage is recommended as the best Hanoi vip massage for men. The Nuru massage method used by this massage parlor originates from the Kawasaki region of Japan, has a relaxing effect on muscles and is good for the human nervous system. Neko Massage is committed to bringing you the best massage in Hanoi, with excellent service experiences securing clean, safe, fun and classy.

3 - Kingspa Land

In addition to Neko Massage, men can also refer to Kingspa Land, located in Cau Giay District, Hanoi City. The enthusiastic staff, professional working style plus affordable service prices are the characteristics that help Kingspa Land become a top Hanoi vip massage parlor. If you want to experience the most new and classy sensations, try coming here.

4 - Omamori Spa

Omamori Spa is a rather special massage place, different from many other massage facilities in this field. Right from the idea of ​​establishing the brand, this spa has chosen its main staff to be the visually impaired. Traveling to Vietnam & Hanoi, in addition to having a relaxing massage, you will also contribute to helping the unlucky people here have more income and improve their difficult lives. Although visually impaired, they still can offer the best massage in Hanoi, and maybe even more attentive than others.

5 - MF Boutique Spa

MF Boutique Spa will be an ideal Hanoi vip massage parlor for those who need a relaxing massage, while traveling in the beautiful and ancient Hanoi city. This place offers Swedish Massage, Vietnamese traditional massage, hot stone massage, foot massage, and many other attractive service packages. With high-class service and professional staff, MF Boutique Spa deserves to be known as one of the best Hanoi massage parlors.

6 - Yoni Massage Hanoi

Hanoi vip massage

Yoni Massage Hanoi specializes in providing massage services exclusively for women in the capital. The staff of the unit are all professional technicians, have many years of experience and are friendly with customers. Coming to Yoni Massage, you will experience moments of relaxation and comfort after a hard working day with the techniques of the best massage in Hanoi.

7 - Zennova Hai Yen - top Hanoi vip massage

Zennova Hai Yen is also a reputable massage place that is quite famous, highly appreciated by many customers. This is a quality destination with a comfortable relaxing space, a team of professional and dedicated staff. With the desire to bring the best service quality to customers, the spa is always conscious of keeping the order and cleanliness, worthy of the title of best Hanoi massage parlor.

**>> See more: https://www.flickr.com/photos/localtravelidea/albums/72157720164085012**

8 - Van Xuan Foot Massage

Next, you should check out Van Xuan Foot Massage, a place that specializes in providing two main services: foot massage and full body massage. If you are looking for a popular massage spa but still ensure the quality of service, then Van Xuan Foot Massage is not a bad suggestion. Many domestic and international guests, after coming here, using the service and experiencing the professional service, have left compliments and said that this place has given them the best Hanoi vip massage.

9 - Da Yen Thao Spa

Da Yen Thao Spa is one of the well-invested massage facilities with modern and advanced equipment, in an airy space of five-star standards. This place also has a staff of more than 5 years of experience, professionally trained, providing rigorous standard service. This best massage in Hanoi parlor is the first choice when you want to relax your body and relax your mind after a day of exploring the ancient capital.

10 - Ocean Spa

As gentle and peaceful as the sea, Ocean spa is one of the parlors created during the massive landing of Korean spa systems about a decade ago. This spa didn’t spread over many massaging fields but only focused on body massage, provided by the professional staff. Under the shimmering candlelight, in the melodious music background and the professional techniques of this Hanoi vip massage parlor, you will surely have moments of relaxation after a day of tiring exploration.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21