Suggested problems

Best Medical Billing Services in the USA

June 27, 2022, 2:54 p.m. by proforma

Biological Motivation

Proforma healthinc is one of the leading medical billing companies in the USA that provides complete medical billing services. With over years of experience in Healthcare, Proforma Healthinc is one of the medical billing companies in the USA that provides comprehensive medical billing Services. The company provides Services with their trained and certified coding specialist.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21