Suggested problems

"Buy Windows 11 Home CD Key Global Rated 5.00 out of 5 based on 2customer ratings (2 customer reviews) $199.99 $27.00 Product Details Brand: Microsoft Availability: In Stock Delivery: Key

June 27, 2022, 11:42 a.m. by buffcom.net

Biological Motivation

"Buy Windows 11 Home CD Key Global Rated 5.00 out of 5 based on 2customer ratings (2 customer reviews) $199.99 $27.00 Product Details Brand: Microsoft Availability: In Stock Delivery: Key – Instructions will be emailed. Delivery time from 30 minutes to 6 hours. Language: Multi-language. License Period: Lifetime Category: Microsoft Windows https://buffcom.net/product/buy-windows-11-home-cd-key-global/

Office365 #Windows10pro #dietvirus #Kaspersky #AvastPremier

"

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21