Suggested problems

nizonide 500 mg tablet

June 27, 2022, 4:55 a.m. by nency

Biological Motivation

[Nizonide 500 pill][1] carries nitazoxanide as much the active ingredient. It is an anti-worm medicine, as is ancient because of the remedy on diarrhea of sufferers suffering beside an contamination appropriate after G lamblia then C parvum worms. This remedy is no longer effective so aged because of the equal infections of HIV contaminated sufferers and human beings including faint immunity.

[> Nizonide 200 acts by inhibiting the increase over that

infection-causing organism, as a result preventing the in addition length on infection. Take it medication so counseled with the aid of your health practitioner for the prescribed duration. Complete the path regarding this medicine, too salvo thou start sense higher then beginning the cure with the Nizonide 500.][2]

Uses regarding Nizonide 500 MG Treatment of diarrhea contamination is broadly speaking caused by using worms such so Giardia lamblia then Cryptosporidium parvum.

Contraindications concerning Nizonide 500 MG If thou hold a acknowledged hypersensitive reaction to nitazoxanide and any lousy member about it medicine.

Side effects over Nizonide 500 MG • Nausea [• Diarrhea][3] • Abdominal discomfort • Dizziness • Skin rash • Difficulty among breathing

[1]: https://www.dozepharmacy.com/product/nitasafe-500mg-tablet-nitazoxanide/ [2]: https://www.dozepharmacy.com/product/nitasafe-500mg-tablet-nitazoxanide/ [3]: https://www.dozepharmacy.com/product/nitasafe-500mg-tablet-nitazoxanide/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21