Suggested problems

Why Do I Have a Stomach Pain & Diarrhea?

June 27, 2022, 4:47 a.m. by nency

Biological Motivation

...Medical Description [Nizonide 500][1] pill carries nitazoxanide as much the active ingredient. It is an anti-worm medicine, as is ancient because of the remedy on diarrhea of sufferers suffering beside an contamination appropriate after G lamblia then C parvum worms. This remedy is no longer effective so aged because of the equal infections of HIV contaminated sufferers and human beings including faint immunity.

Contraindications concerning Nizonide 500 MG If thou hold a acknowledged hypersensitive reaction to nitazoxanide and any lousy member about it medicine.

Side effects over Nizonide 500 MG • Nausea • Diarrhea • Abdominal discomfort • Dizziness • Skin rash • Difficulty among breathing

Precautions then Warnings concerning Nizonide 500 MG • Pregnancy

Q:Can I drink Nizonide 500 pill for the duration of pregnancy? A:Limited facts is on hand of security regarding the utilizes over the Nizonide 500 tablet throughout pregnancy. Do now not receive this medication condition ye are big except prescribed by means of thy doctor.

• Breast Feeding Q:Can I take Nizonide 500 tablet whilst breastfeeding? A:You must keep away from receiving Nitazoxanide 500 mg proviso you are a nursing mother. Consult you medical doctor in relation to its safety then precautions.

• Driving Q:Can I power salvo I hold fed on Nizonide 500 tablet? [A:Nizonide 500][2] tablet do make thou sense bemused yet drowsy. Thus, such is recommended to keep away from or stand exact whilst driving.

• Alcohol Q:Can I eat wine including Nizonide 500 tablet? A:Alcohol is now not known after have interaction along that medicine. However, thou need to avoid the use of potation as like it may extend the restoration yet minimize the body's response to infection/injury.

[1]: https://www.dozepharmacy.com/?s=NITAZOXANIDE&post_type=product&type_aws=true [2]: https://www.dozepharmacy.com/?s=NITAZOXANIDE&post_type=product&type_aws=true

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21