Suggested problems

How To Stop Feeling Bored While Chatting

June 26, 2022, 4:05 p.m. by jacobhue

Biological Motivation

Chatting with someone can be a great way to learn more about them and their interests, but it can also be boring AF if you're not prepared.

The best conversations are the ones where you're able to get a little bit personal, but are still having fun. Having a good time is the best way to make someone feel comfortable opening up to you and getting into a conversation that's truly engaging.

When the other person feels like they can't relax or have fun, they're more likely to start feeling intimidated or nervous, which can lead to an uncomfortable situation for both of you.

[https://www.omegle.fyi/][1] [https://www.chatrandom.one/][2] [https://www.bazoocam.fyi/][3]

Some of my favorite people to chat with are friends who don't really have a lot in common with me—I love it when someone is passionate about a subject I know nothing about!

The problem is that I'm often bored when someone is telling me about their niche interest, but instead of just admitting to being uninterested or letting the conversation die, I keep trying to make it interesting. If you're like me, here's how you can stop being bored while chatting.

In order to stop feeling bored while chatting, you need to first admit that you're bored! Admitting that you're bored is a good way to keep an open mind and be honest with yourself.

Sometimes, admitting boredom is exactly what it takes to start feeling interested again. Once you've admitted you're bored, try not to act too negative or disinterested so as not to ruin the conversation for everyone else.

So how do you keep things interesting, even if you're talking about something serious? Here are some tips for making sure your chats stay fun:

Ask questions that require more than just a "yes" or "no" answer—open-ended questions give the other person more opportunities to speak and share about themselves. If you'd like to steer the conversation toward an interesting topic, try asking what they enjoy doing in their free time.

You can also ask them how they've been or what they think of a certain topic or recent event that's come up in conversation. Just make sure you keep things relevant and don't interrupt them while they're answering!

What if you know how to keep a conversation going, but you just can't get past the awkwardness of the first few minutes? It's like you have all sorts of interesting things to say, but no one is ready to listen.

Well, I have some tips and tricks for you! Here are 5 things that work really well at getting past the initial ice breakers:

1) Take it seriously—if you're bored and your friend isn't interested in hearing about it, they won't be glad when you drag them into a conversation with your problems. It's worth taking a few minutes to prepare yourself so that when someone gives you their undivided attention, you're not boring them. (Sometimes it might even make a better story.)

2) Share something personal—this is a tried-and-true method for making someone want to hear more from you. Trust me; put yourself out there and people will respond by giving of themselves as well. And if they do end up bored? Well, at least you gave it your all.

3) Ask open-ended questions—this is my favorite way to get people talking about themselves. Open-ended questions invite people to talk about their thoughts and feelings.

Friendships require communication, but sometimes it can be a challenge to keep a conversation going. It's so easy to get distracted when you're trying to make small talk with someone—your mind wanders, you stare off into the distance and mentally recite all the things you need to do that day, or maybe you just don't know what else to say.

But there are ways to avoid feeling like your social skills are getting rusty. There are some easy tricks you can try right now that will have them thinking "Wow, this person is so interesting!" instead of "I wish I could get away."

It's easy to get bored at parties, because people are often in small groups talking about topics that don't require much participation from others. It's hard for anyone to stay engaged for long when they're on the outside of an insular conversation.

If you're not a part of the discussion, it's easy to feel like you're just there to be sociable, but you don't have anything substantial to contribute—which is a recipe for boredom.

If you're like me, sometimes you feel like no matter what you do or how hard you try to focus, the conversation is always drifting away from you. You want to think of things to talk about, but you always end up stalling for time and waiting for your turn to come back around.

...

[1]: https://www.omegle.fyi/ [2]: https://www.chatrandom.one/ [3]: https://www.bazoocam.fyi/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21