Suggested problems

Buy Microsoft Office Professional Plus 2019 CD Key Global Rated 4.90 out of 5 based on 10customer ratings (10 customer reviews) $ $60.00 Product Details Brand: Microsoft Availability: In Stock Media T

June 24, 2022, 9:44 a.m. by buffcom.net

Biological Motivation

Buy Microsoft Office Professional Plus 2019 CD Key Global Rated 4.90 out of 5 based on 10customer ratings (10 customer reviews) $ $60.00 Product Details Brand: Microsoft Availability: In Stock Media Type: Key – Instructions will be emailed. Delivery time from 30 minutes to 6 hours. Platform: Windows 10, Windows Server 2019 License Period: Lifetime Category: Microsoft Office https://buffcom.net/product/buy-microsoft-office-professional-plus-2019-cd-key-global/

office #office2019 #WindowsServer2019

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21