Suggested problems

Turkish Airlines Baggage Allowance And Turkish Office In Frankivsk

June 23, 2022, 10:52 a.m. by Peter Son

Biological Motivation

Turkish Airlines Checked/Hold Baggage Allowance The number of sacks you that are permitted to check depends completely on your objective and the sort of flight. Homegrown trips for instance permit you various sizes in view of the sort of ticket you have. Special tickets have a constraint of 15 kg or 33 lb for a real look at the pack. Economy class tickets have a limit of 20 kg or 44 lb for processed snacks. Business-class tickets have a constraint of 30 kg or 66 lb for processed packs. For these as far as possible is something very similar: sacks can't surpass 158cm or 62 altogether. Likewise, there is the greatest weight cutoff of 32 kg or 70 lb on any handled pack. Surpassing the cutoff points for weight in view of the sort of ticket you have will bring about an extra see and surpassing the most extreme weight breaking point will bring about the carrier not delivering your thing or charging you for freight transporting.

Worldwide flights are split between those which utilize a weight idea and those which utilize a piece idea, meaning those that charge in view of the weight and those that charge in light of the amount for hold stuff. Global flights are additionally founded on the kind of ticket you have. For a weight idea flight: Economy class tickets have one free really looked at the pack with a limit of 20 kg or 44 lb. Business-class tickets have a limit of 30 kg or 66 lb for each really looks the pack. For each piece flight: Economy class tickets have 2 free processed sacks with a limit of 23 kg or 50 lb. Business-class tickets have 2 free sacks with a limit of 32 kg or 70 lb for each really look-at pack.

[Turkish Airlines Office Frankivsk][1]

[1]: https://www.justcol.com/address/turkish-airlines-office-frankivsk/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21