Suggested problems

Pure Calms CBD Gummies UK Reviews & Where To Buy?

June 22, 2022, 12:36 p.m. by purecalms95

Biological Motivation

Individuals that are smart and trying to find an innovative way to control their lifestyle are switching over to CBD oil for several good factors. However, not all CBD oils offered out there are safe and offer the claimed outcomes. So, choice of the CBD oils should be done carefully. Pure Calms CBD Gummies UK is the natural and also pure CBD oil sourced naturally from certified hemp plant leaves. It is the CBD oil formulated with pure strength hemp plant as well as it promises to support the users to have complete control over their way of life. It helps them attend to the chronic conditions from root cause as well as enables them to lead a healthy and balanced way of living with no persistent issues. The CBD benefits the individuals in numerous ways by advertising restorative effects. Visit Pure Calms CBD Gummies UK (United Kingdom) Official Website, Know details & Buy At Offer cost. https://gooddiets.co.uk/pure-calms-cbd-gummies-uk/ https://freetrailhealth.com/pure-calms-cbd-gummies-uk-united-kingdom/ https://lexcliq.com/pure-calms-cbd-gummies-uk-reviews-2022-does-it-work/ https://techplanet.today/post/pure-calms-cbd-gummies-uk-united-kingdom-reviews-2022

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21