Suggested problems

Florida Land Clearing

June 21, 2022, 12:50 p.m. by Florida Land Clearing

Biological Motivation

Florida Land Clearing offer the services of Land Clearing, forestry mulching, selective clearing, tree care, grubbing and burning, homesite clearing and development, commercial land clearing, and much more. We serve in Alachua County, Baker County, Bay County, Bradford County, Brevard County, Broward County, Charlotte County, Calhoun County, Clay County, Collier County, Citrus County, Desoto County, Columbia County, Dixie County, Duval County, Escambia County, Flagler County, Franklin County, Gadsden County, Gilchrist County, Glades County, Hardee County, Hendry County, Hernando County, Highlands County, Hillsborough County, Holmes County, Indian River County, Jackson County, Jefferson County, Polk County, Lake County, Lee County, Leon County, Levy County, Liberty County, Madison County, Marion County, Martin County, Miami Dade County, Monroe County, Okaloosa County, Nassau County, Okeechobee County, Orange County, Osceola County, Palm Beach County, Pasco County, Pinellas County, Putnam County, Santa Rosa County, Sarasota County, Seminole County, St. Johns County, St.Lucie County, Sumter County, Suwannee County, Taylor County, Union County, Volusia County, Wakulla County, Walton County, and Washington County.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21