Suggested problems

Friday to Saturday Bitcoin Forecast

June 20, 2022, 3:40 a.m. by change4234

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Bitcoin and Ethereum continued their rapid sell-off Saturday afternoon, with the carnage in the crypto markets showing no signs of slowing down.

At the same time, crypto hedge funds and corporations are facing increasing insolvency issues.

Paxos CEO and co-founder Charles Cascarilla told CNBC: “We're financially unstable because of this opaque leverage, and you have no way of knowing where all these risks are accumulating.”

“I think it's very unfortunate that people are losing money, and I think in a way that's going to hold back the space because you're going to lose some early adopters or some people who are just getting into the space,” Cascarilla continued.

But Cascarilla also said that investors are still looking for high-quality cryptocurrency investments.

“The underlying technology here and the adoption curve we're seeing, the institutions that are coming in, and how you can get your financial system to work at the speed of the internet, those are all things that need to happen,” he said.

Refer: https://www.cmtrade.com

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21