Suggested problems

How to learn SAP

June 17, 2022, 12:56 p.m. by SevenMentor AutoCAD Training

Biological Motivation

... Beside offering you more exact ways, this product likewise provides you with a total image of all corridor of your business. also are the top advantages of exercising the SAP ERP frame. Visit [url=https://www.sevenmentor.com/sap-courses-in-pune.php]SAP Classes in Pune[/url] [url=https://www.sevenmentor.com/sap-courses-in-pune.php]SAP Course in Pune[/url] [url=https://www.sevenmentor.com/sap-courses-in-pune.php]SAP Training in Pune[/url]

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21