Suggested problems

Reserve money moves

June 16, 2022, 9:38 p.m. by mainmanmoney29

Biological Motivation

Best Places to Buy Counterfeit Money online

Best Places to Buy Counterfeit Money online is quality counterfeit vendor. If you are looking for 100% undetectable counterfeit money online then you are in the best place to buy counterfeit money. The counterfeit banknotes we produce are called quality counterfeit banknotes because of their high quality. Do not lose money on low quality counterfeit banknotes that can be easily detected. Contact Banknote With Quality if you are looking for the best place to buy counterfeit money.

Contact Us via

Call/Whatsapp; +1 (708) 880 9644 Email; banknotewithquality@gmail.com Website; https://banknotewithquality.com/ Product Link; https://banknotewithquality.com/best-places-to-buy-counterfeit-money-online/

Buy 100% undetectable counterfeit money online

Are you looking for where to buy 100% undetectable counterfeit money online. To use to buy in super markets/malls, restaurants, gas filling stations, transport stations, parks and for other personal purpose/use. Feel free to contact us. Quality is what you seek for so quality is what you will get. We are the best and Unique producer of QUALITY UNDETECTABLE COUNTERFEIT MONEY. Thus with over a billion of our high quality counterfeit money for sale circulating around the world. Quality Counterfeit vendor offers only original high-quality counterfeit currency notes. Furthermore we ship discretely worldwide. We also print and sell Grade A banknotes of over 150 currencies in the world.

Contact Us via

WhatsApp No; +1 (636) 748 4891 Email; info@qualitycounterfeitvendor.com Website; https://www.qualitycounterfeitvendor.com/ Category link; https://www.qualitycounterfeitvendor.com/category/fake-passports-for-sale/ Product Link; https://www.qualitycounterfeitvendor.com/2020/05/05/buy-100-undetectable-counterfeit-money-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21