Suggested problems

Male Sex dolls | How to remove makeup from TPE sex dolls | globalrealdoll

June 10, 2022, 1:20 a.m. by GLOBALDOLL

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Many of our customers have asked how to get rid of make-up from TPE dolls and change their appearance. We’ve put together the removal of makeup from the male sex dolls guide to help you to follow. By following this guide, you’ll be able to get rid of the makeup on your doll in a safe method. What do you need to prepare for the removal of makeup? TPE-Safe Makeup Remover Makeup cotton pads Baby Powder Headstand Holder Tweezer A Soft Cloth Warm Water Now, let’s get started step by step! Step 1: Remove the doll’s head off, and place it in the headstand holder. This operation will last around an hour, so it’s important to make certain that your doll is simple to reach. Step 2: Take off the eyes and wigs. Gently pull the lower eyelid of the doll down and then insert a tweezer into the eye’s eye socket to eliminate the eyeball. The eyes of the male sex doll are hollow and hemispherical, so that it’s easy to take the eyeball out using your thumb. Removing the eyeballs from the eyes can help protect your eyes from getting soiled by makeup. Step 3: Apply TPE-Safe make-up remover. Place the cotton pad that has been soaked with makeup remover onto the face of your big booty sex doll for a couple of seconds, then gently remove the makeup using it. Make sure you change the cotton pads that are saturated immediately. If not, a pad that is covered in makeup can transfer the makeup residue on the doll’s face. The TPE doll features an even complexion, and there are no flaws to cover and therefore there is no foundation visible on her face. It is all you have to do is focus on removing your eye shadow as well as lipstick, blush, and eye shadow. Tips: Eyeliner and lashes are the foundation of most makeup products, therefore it’s not necessary to take them off unless it is absolutely necessary. Step 4: Wash the doll’s face. Let dry. When the makeup removal is completed and cleanses her face using an abrasive towel and hot water. Step 5: Apply the correct dosage of baby powder onto the face of the doll. To date, all work involved in removing makeup has been done. Now your jasmine sex doll is back to her natural state and is ready to accept her new look!

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21