Suggested problems

Flat Chested Sex dolls | How to make up your realistic female doll

June 9, 2022, 1:14 a.m. by GLOBALDOLL

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

For a lot of customers, the sex doll is not only an instrument for dealing with sexual issues as much as an ally or lover to their dreams. Many flat chested sex dolls enthusiasts are eager to purchase clothing, cosmetics, and jewelry, and accessories to decorate their dolls, and make them more attractive. The real life sex doll is always young, and her unadorned, natural face is stunning. If your doll is well-maintained it shouldn’t need foundation. If you do contact your sex doll’s face often and then some of the ‘makeup may get a little worn off as time passes. In this case, a little make-up and a highlighter could restore that glow! In this blog, we’ll offer some ideas for keeping your beautiful love doll looking as stunning as ever. We will now discuss how to dress up your own flat chested sex dolls. It is essential to have eyebrow pencils, eye shadow, mascara and eyeliner, blush, and lipstick for your basic makeup. Step 1: Take off the makeup that was previously applied. Use a moisturizing product or a makeup remover that is effective and apply it on the cotton. Then, apply it to the face. After that, gently strip off the makeup that was previously applied to your sexually explicit doll. Strategies: 1. It is suggested that you buy makeup removers specifically designed for silicone/TPE dolls. 2. Remove the wig and tie the hair up prior to taking off makeup. Step 2: Cleanse your face with cotton. Cleanse your face with cotton. Step 3: Create your own sexy sex doll. Begin by using the eyebrow pencil lightly to draw in your eyebrows, aiming to make them appear darker. After that follow up by applying the eye shadows over the top and bottom of the eyelids. Make sure to apply the black eyeliner. It expands the eyes of dolls visually. After you’ve finished that, you can put on mascara to improve the appearance of her eyelashes. The mascara can make your doll appear super sexually attractive. Apply the lipstick you prefer. The lipstick’s color must be compatible with the overall makeup. If you are looking for a flirty face, then you should wear red lipstick. If you are a fan of gorgeous and cozy makeup, go for more pastel shades. Then apply a delicate blush of pink gently onto the face of your doll to keep her looking young and fresh look. Now, you are done! Your stunning furry sexdoll is waiting for you. She’s ready to be treated and adored by you.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21