June 6, 2022, 3:35 p.m. by Hurak Learning
Biological Motivation
Which CSCS Card Do I Need?
The cards offered by the CSCS come in different colours, including Green, Red, Gold, Black and White cards. Each colour refers to a certain expertise and experience level. Knowing just which card to apply for can be confusing. This article gives an overview of all the cards, making It easy for you to choose the card appropriate to your role.
Level 1 CSCS Green Card Scheme
The CSCS Green Card scheme includes the [cscs labourer card course][https://hurak.co.uk/courses/online-cscs-green-card-labourers-card-course] aimed at entry-level construction workers.
Green CSCS Card - Labourer
Who Needs a CSCS Green Labourers Card?
You need the CSCS Labourers Card if you want to work on a construction site as a labourer (bricklayer, carpenter, plumber, etc.). The CSCS Green Labourers card proves that the labourer who holds the card is aware of the health and safety risks and hazards present at a construction site.
How Long is the CSCS Green Labourers Card Valid for?
The CSCS Green Labourers Card is valid for five years, after which you will have to apply for a new card.
What are the Requirements for Applying for the CSCS Green Labourers Card?
All the other CSCS cards require you to complete a National Vocational Qualification (NVQ), which may take up to a year. But, the CSCS Green Labourers Card only needs you to pass a CITB Health Safety and Environment test for Operatives and hold a RQF Level 1/SCQF Level 4 Award in Health and Safety in a Construction Environment. You can also hold a CSSC approved alternative qualification; however, an alternative qualification will have an expiry date. You will have to retake them when you apply for a new licence after it expires, while the L1HSCE is valid for life. Click here if you need to do the CSCS Green Card Course or need more information. To book the CITB test, click here
CSCS Red Card Scheme
CSCS red cards are temporary cards aimed at individuals working towards a qualification relevant to their job on site. The CSCS Red scheme includes the Apprentice card, the Experienced Technical, Supervisor or Manager card, the Experienced Worker card, the Trainee card and the Industry Placement card. These cards are non-renewable. Their validity ranges from 6 months to 5 years. The recognised qualification must be completed within this duration.
CSCS Red Card - Apprentice
Who Needs a CSCS Red Apprentice Card?
You need the CSCS Red Apprentice card if you have recently registered with an apprenticeship scheme and want to prove to your employer that you have the health and safety awareness required of an apprentice working on the construction. As a CSCS Red Apprentice cardholder, you are expected to complete your apprenticeship while the card is still valid and apply for a Blue CSCS Skilled Worker or Gold CSCS Advanced Craft Card.
How Long is the CSCS Red Apprentice Card Valid for?
The CSCS Red Apprentice Card is valid for 4.5 years and cannot be renewed.
What are the Requirements for Applying for the CSCS Red Apprentice Card?
To apply for the CSCS Red Apprentice Card, you should be registered on an accredited apprenticeship scheme and have passed the CITB Health Safety and Environment test for Operatives. You may be exempt from the CITB test if the Managing Agency of your Apprenticeship scheme confirms through a letter or email that you have met their Health and Safety requirements, if you have completed a 1-day Health and Safety Awareness course, or if your induction or initial qualification contained a Health and Safety unit. To book the CITB test, click here.
CSCS Red Card - Experienced Technical, Supervisor or Manager
Who Needs a CSCS Red Experienced Technical, Supervisor or Manager Card?
You need the CSCS Red Experienced Technical, Supervisor or Manager Card if you are a Supervisor, Manager or Technical Worker with an experience of more than one year within the last three years and are enrolled in a Level 3 NVQ/SVQ qualification. This is a temporary card. Once your qualification is complete, you can upgrade your card.
How Long is the CSCS Red Experienced Technical, Supervisor or Manager Card Valid for?
The CSCS Red Experienced Technical, Supervisor or Manager Card is valid for three years and is non-renewable. You must complete your NVD/SVQ qualification while the card is still valid in order to move on to apply for a Supervisory or Manager's CSCS Card.
What are the Requirements for Applying for the CSCS Red Experienced Technical, Supervisor or Manager Card?
You can apply for the CSCS Red Experienced Technical, Supervisor or Manager Card if you have registered onto a CSCS recognised Level 3 NVQ/SVQ or higher and do not have an approved professional body membership. You will also need one year of job experience in the last three years. You need to have passed the relevant level of CITB Health Safety and Environment test in the last two years; however, you may be exempt from it. To check if you qualify to be exempt, click here. To find the right CITB test level, click here.
CSCS Red Card - Experienced Worker
Who Needs a CSCS Experienced Worker Card?
You need this card if you are registered onto a construction-related Level 2 NVQ/SVQ qualification accepted by the CSCS and have provable 1-year construction-related job experience within the last three years.
How Long is the CSCS Experienced Worker Card Valid for?
The CSCS Experienced Worker Card is valid for one year and cannot be renewed. The NVQ/SVQ qualification must be completed within this time frame.
What are the Requirements for Applying for the CSCS Experienced Worker Card?
To apply for the CSCS Experienced Worker Card, you must have passed the CITB Health Safety and Environment test at the appropriate level within the last two years.
CSCS Red Card - Trainee
Who Needs a CSCS Trainee Card?
You need the CSCS Trainee card if you are a trainee within a construction-related job and are enrolled in a construction-related qualification.
How Long is the CSCS Trainee Card Valid for?
The CSCS Trainee card is valid for five years and cannot be renewed. You must complete a construction related qualification within this period and apply for the relevant CSCS card.
What are the Requirements for Applying for the CSCS Trainee Card
To apply for the CSCS Trainee card, you must be enrolled in a vocational, academic or professional qualification and have passed the CITB Health Safety and Environment test for Operatives within the last two years. To see if you can be exempt from the second requirement, click here.
CSCS Red Card - Industry Placement Card
Who Needs a CSCS Industry Placement Card?
You need this card if you are enrolled in a construction-related qualification or training programme that requires the completion of a work placement.
How Long is the CSCS Industry Placement Card Valid for?
The CSCS Industry Placement card is valid for three years and cannot be renewed.
What are the Requirements for Applying for the CSCS Industry Placement Card
To apply for the CSCS Industry Placement Card, you must be enrolled in a construction-related qualification that requires a minimum 30-day work placement and have passed the CITB Health Safety and Environment test for Operatives within the last two years.
CSCS Red Card - Provisional (Temporary Only)
Who Needs a CSCS Provisional Card?
You need the CSCS Provisional card during your probation if you have never held a CSCS card before.
How Long is the CSCS Provisional Card Valid for?
The CSCS Provisional card is valid for 6 months and cannot be renewed. You must be registered for a recognised construction-related qualification or have completed it during the validity period of the CSCS Provisional card and then apply for the relevant CSCS card.
What are the Requirements for Applying for the CSCS Provisional Card
To apply for the CSCS Provisional Card, you must have passed the CITB Health Safety and Environment test within the last two years. To check if you can be exempt from this requirement, click here.
Level 2 CSCS Blue Card Scheme
Blue CSCS Card - Skilled Worker
Who Needs the Skilled Worker CSCS Card?
You need the Level 2 Skilled Worker CSCS Card if you are a skilled worker (steel fixer, carpenter, bricklayer, etc.).
How Long is the Skilled Worker CSCS Card Valid for?
The Skilled Worker CSCS Card is valid for five years. The Skilled Worker CSCS Card can be renewed, but you will have to achieve the qualifications again. You can refresh the qualifications at any time, but they should still be valid when you are about to apply for a new Skilled Worker CSCS Card.
What are the Requirements for Applying for the Skilled Worker CSCS Card?
You can apply for the Skilled Worker CSCS Card if you have achieved a Level 2 NVQ/SVQ qualification or have completed a CSCS approved apprenticeship and have passed the CITB Health Safety and Environment test within the last two years. To find the relevant CITB test level, click here.
CSCS Gold Card Scheme
Gold CSCS Card - Advanced Craft
Who Needs a CSCS Gold Card?
You need a CSCS Gold Card if you are a highly skilled worker in a field within the construction industry and have achieved an advanced NVQ/SVQ qualification.
How Long is the CSCS Gold Card Valid for?
The CSCS Gold Card is valid for five years and can be renewed. You must have passed a CITB Health Safety and Environment test for your CSCS Gold Card to be refreshed.
What are the Requirements for Applying for the CSCS Gold Card?
To apply for the CSCS Gold Card, you must have achieved a Level 3 NVQ/SVQ in a construction-related subject and passed a CITB Health Safety and Environment test. You will also need to have completed a CSCS recognised apprenticeship. To check if your apprenticeship meets the CSCS criteria, click here.
Gold CSCS Card - Supervisory
Who Needs a CSCS Supervisor Card?
You need this card if you are working as a supervisor at a construction site.
How Long is the CSCS Supervisor Card Valid for?
The CSCS Supervisor Card is valid for five years
What are the Requirements for Applying for the CSCS Supervisor Card?
You can apply for the CSCS Supervisor card if you have passed the CITB Health Safety and Environment test achieved a Level 3 NVQ qualification in a construction-related subject, and have provable experience working as a supervisor on a construction site.
CSCS Black Card Scheme
Black CSCS Card - Manager
Who Needs a CSCS Black Card?
The CSCS Black Card is the highest available CSCS card. You need the CSCS Black Card if you are working as a manager at a construction site.
How Long is the CSCS Black Card Valid for?
The CSCS Black Card is valid for five years and can be renewed.
What are the Requirements for Applying for the CSCS Black Card?
To apply for the CSCS Black Card, you should have passed the CITB Health Safety and Environment test for Managers and Professionals within the last two years of applying and must have achieved a Level 4 or higher NVQ/SVQ qualification in a Construction Management/Technical subject. You also need experience as a manager within the construction industry.
CSCS White Card Scheme
White CSCS Card - Academically Qualified Person
Who Needs an AQP CSCS Card?
You need the AQP CSCS Card if you have an advanced construction-related degree or certificate, such as HNDs, HNCs, CIOB Certificates or NEBOSH Diplomas. The AQP CSCS Card is especially for professionals who need to occasionally visit a construction site but not necessarily work on one permanently.
How Long is the AQP CSCS Card Valid for?
The AQP CSCS Card is valid for five years and cannot be renewed. Once expired, you must apply for a new card.
What are the Requirements for Applying for the AQP CSCS Card?
To apply for the AQP CSCS Card, you must pass the CITB Health Safety and Environment test for Managers and Professionals and hold a membership of a CSCS approved professional body at the acceptable level. The proof of membership provided must not be older than one calendar year. To find out if your academic qualification is accepted for the AQP CSCS Card, click here.
White CSCS Card - Professionally Qualified Person Who Needs a CSCS, White Card?
You need the CSCS White Card if you have an advanced construction-related skill set. The CSCS White Card is especially for professionals who need to occasionally visit a construction site but not necessarily work on one permanently.
How Long is the CSCS White Card Valid for?
The CSCS White Card is valid for five years and cannot be renewed. Once expired, you must apply for a new card.
What are the Requirements for Applying for the CSCS White Card?
To apply for the CSCS White Card, you must pass the CITB Health Safety and Environment test for Managers and Professionals and hold a CSCS approved professional body membership at the acceptable level. The proof of membership provided must not be older than one calendar year.
[1]: https://hurak.co.uk/courses/online-cscs-green-card-labourers-card-course
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21