June 6, 2022, 8:14 a.m. by FSPCBA
Biological Motivation
Designed PCB Stackup - FS Technology
Before designing a multi-layer PCB circuit board, the designers of FS Technology must first determine the circuit board structure used, that is, decide to use a 4-layer, 6-layer or more circuit board, and then according to the size and electromagnetic compatibility of the circuit board. (EMC) requirements to determine the size of the circuit board. After determining the number of layers, determine where to place the internal electrical layers and how to distribute the different signals on these layers. This is the choice of the multilayer PCB stack-up structure. Laminated structure is not only an important factor affecting the EMC performance of PCB boards, but also an important means to suppress electromagnetic interference. This section will introduce the related content of the multi-layer PCB board stack-up structure of FS Technology. After each PCB engineer counts the number of layers, each PCB engineer cannot avoid the relative arrangement between them;
fs tech
All signal layers as close as possible to the ground plane;
Try to avoid two signal layers directly adjacent to each other; crosstalk is easily introduced between adjacent signal layers, resulting in circuit failure. Effectively avoid crosstalk by adding a ground plane between the two signal layers.
The main power supply should be as adjacent as possible;
The symmetry of the laminate structure.
For the layer layout of the motherboard, it is difficult to control the parallel long-distance wiring of the existing motherboard. For the board-level operating frequency above 50MHZ (refer to the operating frequency below 50MHZ and relax it appropriately), FS Technology recommends the arrangement principles: Component surface. The welding surface is a complete ground plane (shielding); No adjacent parallel wiring layers; All signal layers as close as possible to the ground plane; Critical signals are adjacent to the formation and do not cross the segmented area.
Note: When setting the layers of a specific PCB, the above principles should be flexibly grasped. On the basis of understanding the above principles, according to the needs of the actual single board, such as: whether a key wiring layer, power supply, and ground plane division are required, etc. , to determine the arrangement of the layers, do not rigor or hold on to it.
FS Technology - the best circuit board manufacturer in the world
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21