Suggested problems

Chemical safety problem

June 2, 2022, 8:57 a.m. by andrewexp

Biological Motivation

For anyone who needs a modern solution in the world of safety data sheets, I can advise chemical safety software - https://sdsmanager.com/ that will help workers in both large and small industries with the problem of chemical safety, thanks to which you can manage chemicals safely and efficiently without endangering the lives of workers.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21