Suggested problems

lifelike sex doll faces high and low temperatures - lifelike sex doll

June 2, 2022, 12:42 a.m. by GLOBALDOLL

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

lifelike sex doll afraid of heat or cold?The real expert advice is to treat the TPE material in sex dolls as human skin. Lifelike sex dolls mainly have the ability to resist extreme temperatures,including high and low temperatures. However, for the exact temperature range suitable for polymer materials, this statement is not very clear. People usually think that the temperature should be kept at-40ºC and 140ºC, but there is no evidence or research that this precise temperature range is correct. Studies have shown that you should avoid using water above 40ºC to clean your TPE realistic sex doll; warm or hot water will cause the best sex dolls to lose its consistency and begin to melt. Dolls are like human skin. When exposed to very high temperatures, the skin becomes soft and burns. TPE is a very soft material, it is easier to stretch back and forth, but once its consistency is destroyed, The lifelike sex doll effect will not be reversed. Compared with TPE material, silicone material can withstand extremely high temperatures

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21