Suggested problems

Prima Weight Loss UK Pills Reviews [Dragons Den] Tablets, Capsules, Diet | Where to buy?

May 31, 2022, 10:43 a.m. by angelapriestes

Biological Motivation

Prima Weight Loss With the assist of this ketogentic gummies you can do away with pollution and overweight. Simpli fitness ACV Keto Gummies is positive and secure manner to fight overweight because it is fabricated from natural ingredients. So, the girls who've her perfect picture in her head does no longer see herself as apathetic special with negative pores and skin and dull sparse hair. Then try this #1 gummies. In case you want to recognise more approximately those gummies then study this text otherwise the hyperlink of reliable webiste is given under, simply click the hyperlink and make your dream real.

Visit For More Info@>> https://www.orlandomagazine.com/prima-weight-loss-pills-uk-dragons-den-tablets-side-effects-where-to-buy/ https://www.jpost.com/promocontent/prima-weight-loss-uk-pills-reviews-dragons-den-tablets-capsules-diet-where-to-buy-703720 https://prima-weight-loss-uk-pills-2.jimdosite.com/ https://www.facebook.com/Prima-Weight-Loss-Pills-101408675913880 https://www.instagram.com/weightlossprime1/ https://www.reddit.com/user/weightlossprime1/comments/uombz0/prima_weight_loss_capsules_product_test_uk_scam/ https://www.pinterest.com/primeweightloss/prima-weight-loss-pills/ https://twitter.com/prime_weight https://www.linkedin.com/pulse/prima-weight-loss-uk-reviews-exposed-updated-scam-pills-losspills/ https://prima-weight-loss-pills.tumblr.com/ https://www.quora.com/profile/Prime-Weightloss https://www.tripoto.com/profile/weightlossprime

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21