Suggested problems

Coronavirus Symptoms and Daily Life

May 30, 2022, 6:26 a.m. by Sunidhi

Biological Motivation

A Rapid Introduction to Molecular Biology

The [coronavirus][1] is disseminated through droplets and virus particles released into the air when an infected person breathes, talks, laughs, sings, coughs, or sneezes, according to researchers. Larger droplets may fall to the ground in a matter of seconds, but microscopic infectious particles can persist in the air and concentrate in enclosed spaces, particularly where a large number of people are assembled and ventilation is poor. [COVID-19][2] prevention necessitates the use of masks, hand cleanliness, and physical separation. On December 1, 2019, the first case of COVID-19 was announced, and the cause was a new coronavirus known as SARS-CoV-2 at the time. SARS-CoV-2 may have begun in an animal and then developed (mutated) into a human-infectious virus. Viruses that originated in birds, pigs, bats, and other animals in the past evolved to become dangerous to humans, resulting in a variety of infectious disease outbreaks. More research is needed to figure out how and why the coronavirus became capable of causing pandemic illness. Symptoms appear two to fourteen days after a person has been exposed to the virus. A person infected with the coronavirus can be communicable to others for up to two days before symptoms develop, and for 10 to 20 days after symptoms appear, depending on their immune system and the severity of their sickness.

[1]: http://thetechgrow.co.in/ [2]: http://thetechgrow.co.in/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21