Suggested problems

Indian Classical Music| Music OF India

May 30, 2022, 6:18 a.m. by Teena Rani

Biological Motivation

[Indian][1] classical music, as well as many types of folk, popular, pop, and, most recently, rock music, are all part of the Indian musical landscape. The Vedas, the earliest Hindu writings, contain the origins of Indian classical music. The Samaveda is thought to have created the foundation for Indian music, and it consists primarily of Rigvedic hymns adapted to melodies that would be chanted during [Vedic][2] sacrifices employing three to seven musical notes. Rather than simply being a form of self-expression, Indian classical music was seen as a method of self-realization and redemption. Carnatic, which is primarily found in the peninsular portions of India, and Hindustani, which is primarily found in the northern and central parts, began to diverge. Both traditions started to diverge with the emergence of the Islamic Delhi Sultanate in the north about the thirteenth century, from a common musical root. Musicians from Persia and Central Asia are said to have introduced Persian and Turkic elements to Hindustani music.

...

[1]: http://nextlevelupdates.com/ [2]: https://bestidprovider.blogspot.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21