Suggested problems

Prima Weight Loss Pills UK (Dragons Den, Tablets) Side Effects | Where to Buy?

May 27, 2022, 7:16 a.m. by marisalanees

Biological Motivation

You can resultseasily buy Prima Weight Loss products from the producer's valid internet site. This is a product that isn't always to be had in any nearby shops. The motive why you cannot purchase this product anywhere out of your nearby markets is that the enterprise desires all of the customers to acquire only legitimate products. That is why they promote it best on their reliable internet site, and because of this, you can not get it from anywhere else.

Visit For More Info@>> https://www.orlandomagazine.com/prima-weight-loss-pills-uk-dragons-den-tablets-side-effects-where-to-buy/ https://www.jpost.com/promocontent/prima-weight-loss-uk-pills-reviews-dragons-den-tablets-capsules-diet-where-to-buy-703720 https://prima-weight-loss-uk-pills-2.jimdosite.com/ https://www.facebook.com/Prima-Weight-Loss-Pills-101408675913880 https://www.instagram.com/weightlossprime1/ https://www.reddit.com/user/weightlossprime1/comments/uombz0/prima_weight_loss_capsules_product_test_uk_scam/ https://www.pinterest.com/primeweightloss/prima-weight-loss-pills/ https://twitter.com/prime_weight https://www.linkedin.com/pulse/prima-weight-loss-uk-reviews-exposed-updated-scam-pills-losspills/ https://prima-weight-loss-pills.tumblr.com/ https://www.quora.com/profile/Prime-Weightloss https://www.tripoto.com/profile/weightlossprime

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21