May 26, 2022, 8:56 a.m. by Tobey Washington
Biological Motivation
1982 and 1985 are years of special significance for Nike as they are the respective birth years of two of the most recognizable shoe silhouettes in history, the [Buy Fake Air Force 1 Mid][https://www.repkicks.org/air-force-1-mid-reps.html] and the Air Jordan 1. Both models were so popular from the start that they have also taken off beyond the basketball court and have come onto the market in a wide variety of versions over the past few decades. They've been canvases for artists (including Dave White and Mister Cartoon), fashion houses (from Comme des Garí§ons to PSNY), and more. The two models have long outgrown their use on the court. Now, 14 in-house Nike designers have completely reworked these silhouettes for the first time, giving birth to the 1 Reimagined series. Her work focused on creating five individual reinterpretations of both legends: Explorer, Love, Wisdom, Rebellion, and Fun.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
