May 21, 2022, 3:15 p.m. by zombara
Biological Motivation
Product Details Brand: Microsoft Availability: In Stock Delivery: Key – Instructions will be emailed. Delivery time from 30 minutes to 6 hours. Language: Multi-language. License Period: Lifetime https://zombara.com/product/windows-10-education-key-global/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21