Suggested problems

vệ sinh công nghiệp

May 21, 2022, 2:32 p.m. by vệ sinh công nghiệp

Biological Motivation

Thịnh Phát là công ty uy tín và chuyên nghiệp trong lĩnh vực [vệ sinh công nghiệp][1] tại tphcm, với đội ngũ nhân viên lành nghề đươc đào tạo chuyên nghiệp, được sử dụng máy móc và thiết bị hiện đại nhất và hoá chất nhập khẩu được kiểm định. Thông tin liên hệ: https://www.vesinhthinhphat.com/vi/dich-vu/ve-sinh-cong-nghiep/ Địa chỉ: 561a điện biên phủ, p25, quận bình Thạnh, hcm, google map: https://goo.gl/maps/q3NiexDxiQ9yP1Rs7 sdt: 0933841166. Email: vesinhthinhphat.vn@gmail.com

Vệ sinh công nghiệp #ve sinh cong nghiep #dịch vụ vệ sinh công nghiệp #dich vu ve sinh cong nghiep #dịch vụ đánh bóng sàn gỗ #dịch vụ đánh bóng cầu thang.

[1]: https://www.vesinhthinhphat.com/vi/dich-vu/ve-sinh-cong-nghiep/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21