Suggested problems

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Mia sex doll worth thousands of doll ars are booming in Canada One major distributor told the Daily Mail that orders from Canada are up at least 35% The “companion doll” has a realistic skin that mimics the body’s temperature Some are actively using confinement to master a musical instrument or learn a new language, but Canadians living at home have a new interest in sex dolls. During the COVID-19 pandemic, Fantasy sex dolls with realistic skins that mimic the temperature of the human body are accompanied by more and more locked-in residents. Sell doll girls, this is a very good sex doll dealer Sales of “Fantasy sex dolls” or “love dolls” have soared as social opportunities have dried up. One leading distributor said orders had surged 35 per cent since the lockdown began in March. It turns out that dolls are popular during the cold winter months because they ‘adapt to your body temperature’ Mr James explained: ‘A lot of people choose to sleep with them and hug them rather than leave the heater running all night.’ Fantasy sex dolls are imported from China and are made of thermoplastic elastomer, which combines the characteristics of rubber and plastic to give people a soft skin feel. The most popular model, according to James, is a WM doll called Lara, which sells online for $3,100. He said: “This Fantasy sex doll is a black man, with blond hair and blue eyes, wearing a military uniform.” “best sex dolls are definitely our most popular. She is very healthy, athletic and an excellent athlete. 157cm camouflage pants sexy girl European sexy girl camping Fantasy sex dolls Isabella This fantasy sex dolls is the famous real doll brand WM Dolls. The price of globalrealdoll.com is $1,899 The company has now started keeping local dolls in stock at its Sydney factory, so customers don’t have to wait two to three weeks for delivery. Sales of sex toys in the female market have also soared along with male lover dolls. “But for all of us, social connections contribute to good mental health, so it’s important to maintain some level of engagement with social networks.” “This can be as simple as calling a friend or writing a letter to share your experience, using videoconferencing technology to connect with family, or spending quality time with the people you live with.” Do you want to buy a real doll? In a boring and scary year. We believe that this porn sexdolls can make you face the loneliness of life.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21