Suggested problems

newest sex doll will replace real women(Trigger warning)

May 21, 2022, 12:46 a.m. by GLOBALDOLL

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Small sex doll will replace women. While different people will buy real dolls for different reasons, everyone will appreciate the unparalleled degree of obedience that the sexy goddess has. Dolls are always ready for you, always eager to release your pressure, and never complain. In fact, a real inflatable doll is thought to be better than a woman in bed. How? Some people will ask. This magical artwork brings unparalleled sexual pleasure, and its moving joints make it more flexible; this means you can effortlessly perform any sexual stunts on the doll. 12Reasons Why Real Dolls Are Better than Real Women Sex dolls have different shapes and sizes from torso to mini dolls and finally life-size sex dolls. This is to satisfy the tastes and preferences of the growing broad market. The most amazing thing about sex dolls is absolutely that these magical help are still virgin and unaffected until the day you cancel them (after you buy her, of course). The doll is tame and you don’t have to worry about infidelity or maintaining “standards” to keep her with you; if you take care of her, she always provides you with an amazing sexual experience. Furthermore, these magical creatures have no hormonal imbalances and mood swings, which is actually a very surprising factor for men, as it means that dolls remain calm throughout the entire “relationship.” After learning the foundation and amazing benefits of having a realistic doll, we will explore 15 reasons why sex dolls are naturally better than women. These reasons include:; Sex dolls do not require support payments  Sex dolls are ideal when you don’t want to worry about caring for your partner during or after a relationship. The only form of support you need to provide for sex dolls is cleaned and properly stored regularly during use. 2. with sex dolls, sperm will not be stolen Sex dolls can come in handy because they can prevent any sperm theft. After having sex with the baby, the owner should immediately clean the baby, usually simply by removing the water from the hole to remove semen. While this does not explicitly eliminate the possibility of sperm theft, it greatly reduces this possibility. So the key to using these recreational tools is to ensure that the doll is cleaned as soon as possible after sexual intercourse. Sperm theft is very serious and will be punished by the law, and sex dolls can curb this bad habit. This should be a reason to go to sex stores and buy the happy doll you always wanted. 3. You don’t have to worry about child support payments Considering that sex dolls are inhumane and unable to conceive, it is impossible to have sex with these happy goddesses, regardless of intensity and frequency. In 2015, noncustody parents paid more than $ 33 billion in child support, and people could not help liking sex dolls. 4. You will never get infected STDs (STI) Sex dolls completely eliminate the risk of STD. Until the day you bought them, these happy AIDS kept their initial state, unaffected, and these substances kept them clean from STDs. More importantly, you are the only partner in the relationship. Therefore, you don’t have to worry about the doll to be “externally” infected to you. Realistic sex dolls are definitely the most loyal partners. You don’t have to worry about them running around. Sex dolls are fully tackable and always serve you. Unlike women, sex dolls belong entirely to you. The only way you get apart is if you decide yourself; you are basically the relationship. 6. sex dolls have very low maintenance requirements Dolls are inhuman, that is, dolls have no emotion and will never be sick or depressed as humans. Unlike women, dolls don’t need expensive daily entertainment and dating. In fact, give her a few clothes, a good locker, regular cleaning, and you are done. Amazing one. Correct? Well, this is definitely an important reason why sex dolls are better than women. The 7. box has her full price tag on the You will not incur any additional costs except for the initial costs you pay when you purchase the sex dolls. This is a good career considering the daily expenses women need. From regular hair care, frequent manicures and pedicures, and normal dating nights, women can be very luxurious for maintenance. Sex dolls, on the other hand, do not need such a special treatment and an extravagant life. 8. lifelike sex dolls never attract attention Unlike women who are willing to do something incredible to attract attention, sex dolls are quiet and calm at any time. Under the circumstances, these hedonists always remain calm. It is actually surprising to see that women bend over at any level and compete with their peers to gain attention. Women can do almost anything, from wearing games to using their bodies to attract attention. 9. Sex dolls are never a bitch when you play video games or decide to spend time with friends Every woman needs to focus on and commit to changing their lifestyle, which is definitely friends and video game for most men. Over time this can become a problem as men tend to quickly back to their original lifestyle. Sex dolls, on the other hand, are not affected by any aspect of your life, which makes them better than women. 10. The inflatable doll will not stare at the phone An important turning point in a relationship must be that the other person is always calling, especially when they should ‘ t call. In fact, frequent calls are the main cause in minor disputes. Imagine the backlight of your phone hitting on you when you gently bend over and kiss your partner? It wasn’t very cool. Correct? Sex dolls, on the other hand, lack intelligence to perform complex tasks, such as operating machines or handheld devices, which means they focus on one thing; meeting your sexual needs (and, of course, some good partners). This is definitely a good reason why they are better than women; you can rest assured that you will receive continuous dedication and commitment. 11. A real inflatable doll won’t test you Women to let men take responsibility, do anything in the name of “testing their commitment and love”. While I believe the real circumstances expose real people, exams can be harmful to women. In fact, the unqualified exam was the main cause of the broken marriage. Sex dolls will never test you. They do not think and reason, which makes them very obedient to you. 12. Sex dolls never have dramatic scenes Women acting in public are indecent, especially when they want to drive home. However humiliating (for both of you), they will redouble their efforts; they ignore the possible consequences, including property losses or prolonged defamation. According to the survey, one-third of American women have acted out of anger and created dramatic scenes in their relationship. Sex dolls are never noticeable in a relationship. This is an amazing aspect of sex dolls and a better indicator for dolls than women.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21