May 20, 2022, 9:54 a.m. by Little life
Biological Motivation
Fixed asset management is the process of ensuring an organization's assets are accounted for, deployed, maintained, upgraded, and disposed of when the time comes. Put simply, it's making sure that the valuable items, tangible and intangible, in your organization are tracked and being [used][1].
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21