Suggested problems

Biological Motivation

With so many [mobile phones][1] available in pakistan, its becoming difficult choose the best phone for you, So after a lot of research from different sources like PricesPakistan, We have a made list of possible best 3 phones along with their price in pakistan that are available in pakistan market right now [Tecno Spark 8][2] [Realme C35][3] Samsung Galaxy F23

[1]: https://pricespakistan.pk/ [2]: https://pricespakistan.pk/product/tecno-spark-8/ [3]: https://pricespakistan.pk/product/realme-c35/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21