May 13, 2022, 2:41 p.m. by lavishnailspa
Biological Motivation
Luxury Space: You will be satisfied with the spacious, luxurious and clean space Modern Technology: 100% modern machinery and equipment. You will enjoy the best feeling. Safe Products: Products are directly imported, extracted from natural ingredients and especially have no side effects, so they are absolutely safe. Highly Skill Technicians: Professional technicians with high skills will meet all your needs, helping you have the best experience. Company: Lavish Nails & Spa Address: 1616 Battleground Ave Suite F, Greensboro, NC Phone: (336) 988 9997 Mail: lavishnailspanorth@gmail.com Website: https://teletype.in/@lavishnailspa
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
