May 12, 2022, 2:36 a.m. by gerrymax
Biological Motivation
If you have the Yahoo notification option activated, you can get weather, stock, sports, business, national, and international news updates on your phone right away. However, if you face Yahoo notifications not working, you haven't enabled Yahoo mail notifications. To begin, go to 'Settings' on your device and select 'Notifications.' Then select the Yahoo Mail app and hit the toggle button to accept notifications. Toggle the toggles to activate various notification types. In your Yahoo Mail app, you may also enable alerts. To do so, go to the profile section of your Yahoo mail app and pick notifications. Then, click on 'Allow notifications for all messages and features' or 'Just the categories I choose' from the drop-down box. Select the toggle to enable the sorts of alerts you wish to receive.
Visit for more detail https://contactforservice.com/why-am-i-not-getting-yahoo-mail-notifications/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
