May 10, 2022, 10:53 a.m. by harry986
Biological Motivation
Prime Valley housing society Rawalpindi, another marvelous residential project initiated by Naya Pakistan housing scheme to give natives another opportunity to invest and live in an eco-friendly, highly facilitated and much less expensive living environment. The location of the housing society highly appeals to the investors as it is one of the reasons the project assures high ROI. [prime valley][1] is approved by TMA that is why it is certain that the project will be completed soon without facing much hurdles. The legality of a land assures that its buyer will not be scammed in any way so buying property in Prime Valley allows you to be at peace and get fully benefitted.
[enter link description here][2]
[1]: https://www.makeenmarketing.com/prime-valley-rawalpindi/ [2]: http://primevalley.com
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
