May 6, 2022, 7:10 p.m. by Winning Paradise
Biological Motivation
Excited about the places where you can enjoy a great night with food, drinks, dancing, and a lot more. Enjoy the [top 10 nightlife cities][1] that offer you everything from dive bars to swanky hotel lounges to trendy dance clubs. Read the complete blog at: https://www.winningparadise.com/top-10-cities-town-for-nightlife-and-party-in-the-world
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
