May 5, 2022, 9:17 a.m. by windyn123
Biological Motivation
wordle online is a great game to have on hand when you're down, tired, or just need a little reminder that life is beautiful! By playing Wordle, you can learn new words and phrases in the world around you. The possibilities are endless.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
