Suggested problems

Biological Motivation

if you search any [ost mailbox converter software][1] try stella ost to pst converter software to convert all ost file data in to pst file this software is convert all ost mailbox items in to office 365 account this software is convert all ost mailbox items like emails items, contacts items, calendars items, task items and many other items in to pst file this software is support all version 32bit 64bit ost file this software is convert all deleted items data in to pst file. for more info visit this link https://www.stelladatarecovery.com/ost-to-pst-recovery.html

[1]: https://www.stelladatarecovery.com/ost-to-pst-recovery.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21