May 1, 2022, 9:14 a.m. by Himalayan Frozen Adventure
Biological Motivation
[Langtang Valley Trek][1] gets into the massive glacier valley of Himalayan, this Langtang trek is one of the most popular short and easy treks in Nepal. Not only does the trek offer a journey of reasonably moderate effort through a scenically dramatic alpine region well worth visiting in its own right, but it also has the added benefit of being very accessible from Kathmandu, minimizing travel and days wasted for those who want to focus their limited time on trekking, rather than onerous bus or jeep rides.
[Langtang Valley Trek route][2] is the most attractive tourist destination in Nepal after Annapurna and Everest Treks, you will discover the wide range of flora and fauna and enjoy the traditional, local lifestyle, and unique culture of the Tamang and Sherpa community. Get ready to see up-close panorama mountains views of Ganesh Himal and Langtang ranges.
[Langtang Route][3] begins from Syabru Bensi and walks through the beautiful landscapes, traditional villages, amazing waterfalls, and up to the valley’s alpine pastures, yak herds, and the entrancing monastery of Kyanjin Gompa and its unique Yak cheese facility. Optional climbs to Kyanjin Ri (4773m) or Cherko Ri (4984m) offer stunning panoramic views of the valley and surrounding mountains. If you wanna trek Langtang Valley with Gosaikunda Lake then click here.
...
[1]: https://www.himalayanfrozen.com/langtang-valley-trek [2]: https://www.himalayanfrozen.com/langtang-valley-trek [3]: https://www.himalayanfrozen.com/langtang-valley-trek
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
