Suggested problems

15 Precious Tips To Help You Get Better At Mayim Bialik CBD Gummies.

April 27, 2022, 8:33 a.m. by MayimBialikCBDprice

Biological Motivation

Mayim Bialik CBD gummies:-So what would you be able to expect when you initially begin taking Mayim Bialik CBD Gummies chewy candies? There are many advantages that CBD offers. For instance, chewy candies can be utilized to treat persistent agony by limiting irritation all through the body. CBD chewy candies moreover:

ORDER NOW:-https://www.fingerlakes1.com/2022/03/26/mayim-bialik-cbd-gummies-official-website-reviews-usa-smilz-cbd-gummies-mayim-scam-or-trusted/

https://www.mynewsdesk.com/healthyworldstock/pressreleases/lifestyle-keto-reviews-know-all-about-side-effects-and-unsatisfied-amazon-customer-reports-for-2022-3175215

https://www.mynewsdesk.com/healthyworldstock/pressreleases/apple-keto-gummies-australia-au-reviews-rebel-wilson-keto-bhb-with-calcium-and-magnesium-read-detailed-report-2022-3158759

https://www.jpost.com/promocontent/lifestyle-keto-pills-reviews-website-scam-2022-weight-loss-shark-tank-and-does-it-work-703943

https://www.jpost.com/promocontent/gemini-keto-gummies-reviews-price-exposed-2022-shark-tank-scam-alert-and-where-to-buy-703725

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21