Suggested problems

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

What Is A sex dolls and How Does It Work? sexiest sex dolls can be super sophisticated sex toys designed for men. All sex dolls have mouths and vaginas. This allows men to have simulated sex. Are sexiest sex dolls Inflatable?Your grandfather’s sex dolls were made from polyvinyl chloride resin. They resembled more a beach ball than a real life sex doll. Today’s sex dolls, made from silicone materials or TPE, feel and look like real females. Is it safe for the sexiest sex dolls? Sex dolls can be used to have sex because they’re made with silicone or thermoplastic elastomer, which are nontoxic materials that won’t cause harm. TPE sexiest sex dolls stands for Thermoplasticelastomer. It’s a type plastic that is very flexible and can be stretched up 5.5 times. TPE is much easier to stain than silicone. However, it feels more like silicone.Silicone, which can be described as a polymer is non-porous, more sensitive to heat and usually easier to clean then TPE. Are sex dolls Tiny.sexiest sex dolls, contrary to popular belief, look and feel exactly the same as real women. They can range in size from 4’8″ through 5’8″, and everything between. Are Sex Dolls Slut?Nope. These dolls can be used in many different sexual positions, such as reverse cowgirl to doggy or reverse cowgirl.TPE sex dolls offer more flexibility than silica sex dolls. Do Sex Dolls need to be cleaned? sexiest sex dolls must be cleaned.Condoms can be worn by some owners of sex dolls to help with cleaning. But condoms should never be used by anyone who isn’t. How long does a sex doll last?There are many sex dolls on the market, with prices starting at $2,000 and ending at $6,000+. It is important to find out how long they last. This is also something to keep in mind when choosing between silicone and TPE dolls.TPE sex dolls are generally around 6-10 years old depending on what manufacturer they were purchased from.While silicone sex dolls are able to last for decades, they can only live up to 15 to twenty years on average. Why Does Silicone sex Dolls Last Longer Than TPE Dolls. Silicone has a non-porous surface, making it impermeable in sexual fluids. It is also easy to clean. TPE dolls can accumulate fluids much faster than silicone, which affects sterilizing and cleaning. Silicon dolls last longer because they have more elasticity than TPE dolls. Because silicone material has a harder surface than TPE, TPE dolls have a more flexible and lifelike feel. TPE dolls also last half as long. sex dolls will last much longer than most marriages. They are also far more affordable than real women. Where are the sexiest sex dolls Keepned When Not In Use?sex dolls should always be stored vertically. Single men often keep their dolls under their covers or in bed with them. If discretion is an issue, then closets make great hiding spots. Are sexiest sex dolls good for your body?sex dolls can provide many benefits for men, both emotionally as well as physically. To remain emotionally, psychologically, and physically stable, men must have sex. Men who aren’t able to have sex are more likely to feel frustrated, be more prone to violence, and to act out in anger. But men who are sexually satisfied are confident and calm. Because they are real, adult sex dolls offer men the same benefits and benefits as having sex in real life with a woman. Are sexiest sex dolls Worth Their Price? sex dolls may be priced between $2,000 and $6,000. But can you really price great sex at that price? No you can’t. Additionally, sexiest sex dolls don’t need gifts or flowers; they can expect all the things real women have on a day to be with them.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21