Suggested problems

SINAMASR

April 24, 2022, 9:28 p.m. by SINAMASR

Biological Motivation

[url=https://toshibabenisuefe.wordpress.com/]رقم صيانة توشيبا بني سويف[/url] [url=https://toshibaminya.wordpress.com/]رقم صيانة توشيبا المنيا[/url] [url=https://toshibaasiout.wordpress.com/]رقم صيانة توشيبا اسيوط[/url] [url=https://toshibatanta.wordpress.com/]رقم صيانة توشيبا طنطا[/url] [url=https://maintenanceoftoshibakafrelsheikh.wordpress.com/]رقم صيانة توشيبا كفر الشيخ[/url] [url=https://toshibamahalla.wordpress.com/]رقم صيانة توشيبا المحله[/url] [url=https://toshibadamanhour.wordpress.com/]رقم صيانة توشيبا البحيرة[/url] [url=https://fayoummaintenance.wordpress.com/]رقم صيانة توشيبا الفيوم[/url] [url=https://toshibaportsaid.wordpress.com/2018/11/29/%D8%B9%D9%86%D9%88%D8%A7%D9%86-%D9%85%D8%B1%D9%83%D8%B2-%D8%B5%D9%8A%D8%A7%D9%86%D8%A9-%D8%AA%D9%88%D8%B4%D9%8A%D8%A8%D8%A7-%D8%A7%D9%84%D8%B9%D8%B1%D8%A8%D9%89-%D8%A8%D9%88%D8%B1%D8%B3%D8%B9%D9%8A/]رقم صيانة توشيبا بورسعيد[/url]

[url=https://toshibabenisuefe.wordpress.com/]مركز صيانة توشيبا بني سويف[/url] [url=https://toshibaminya.wordpress.com/]مركز صيانة توشيبا المنيا[/url] [url=https://toshibaasiout.wordpress.com/]مركز صيانةتوشيبا اسيوط[/url] [url=https://toshibatanta.wordpress.com/]مركز صيانة توشيبا طنطا[/url]

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21