Suggested problems

How bolstering Feedstock trends augmenting the global Acetaldehyde Market

April 22, 2022, 12:04 p.m. by chemanalyst

Biological Motivation

[Acetaldehyde prices][1] have continued to rise in the global market in April, owing to restricted supply and increased demand from downstream sectors to manufacture fire protection paint in the paint and coating industries. Acetaldehyde Bulk Ex-Ankleshwar (India) prices were USD 1744/MT while Ex- Bhiwandi (India) prices were USD 2146/MT with the month-on-month inclination of 1% during April according to the ChemAnalyst database.

The ongoing Russian invasion of Ukraine has influenced all commodity markets, including a spike in crude oil prices, which has impacted feedstock costs such as Ethylene, putting cost pressure on petrochemicals such as [Acetaldehyde demand][2]. The Asia-Pacific region's downstream demand for fire protection paints has surged, prompting producers to raise production rates. Companies have had to raise the cost of Acetaldehyde production due to a scarcity of the feedstock Ethylene. Furthermore, the Covid outbreak in China and the shutdown of several cities slowed the flow of upstream products from providing countries, placing downward pressure on Acetaldehyde prices in the local market. Similarly, European market sentiments had seen an increased trend in Acetaldehyde prices due to the rising cost of Crude oil. Because Europe relies significantly on Russian oil gas, the growing risk to Europe's gas and oil supply and variable feedstock prices has become a significant issue for European Acetaldehyde producers and customers. Furthermore, the United States sanctions on Russian oil imports pushed up Crude oil prices in Europe.

Acetaldehyde, also known as Ethanal, is a chemical used to generate fragrances, colours, and pharmaceuticals and a substrate for other compounds like acetic acid and ethyl acetate.

According to [ChemAnalyst][3]. "The price of Acetaldehyde is projected to climb in the next weeks due to growing demand from the paints and coatings sector. Meanwhile, the price of upstream crude oil is expected to rise, thereby impacting feedstock prices, especially Ethylene, in the worldwide market."

[1]: https://www.chemanalyst.com/Pricing-data/acetaldehyde-1124 [2]: https://www.chemanalyst.com/NewsAndDeals/NewsDetails/how-bolstering-feedstock-trends-augmenting-the-global-acetaldehyde-market-9612 [3]: https://www.chemanalyst.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21